Re: Speculative Design Hypothesis (with predictions) 2nd draft



Wall Of Sleep wrote:

John Harshman wrote:


Wall Of Sleep wrote:



John Harshman wrote:



Wall Of Sleep wrote:

[snip]



The vast majority involve some sort of superior being creating life.
If you want to say that's not true - please cite actual examples and
give me the percentage of known legends these "anomalies" represent.


So we've gone from "always" to "vast majority", have we? And is a coyote
a "superior being"?

I believe my original words were "virtually every" - not "always". I did
not mean to imply that *all* legends agree, just the vast, vast majority
of them. I'll change the wording in the next draft.


Why not change it to "some", because that would better represent the
situation and your knowledge of world mythology?


Because "some" would not be accurate. It really is more like "most" than
"some" - and I think you know that.


Not so. My knowledge suggests that "some" is more appropriate. You need
to consult an expert. May I suggest Mark Isaak, a regular on TO, who has
studied quite a bit of world mythology?

I supplied a link in my original post to a comparative myth site. There
are many other sites that reinforce my point. I've yet to see from you
or anyone else an ancient legend that does not support my argument. If
you want to at least provide a link to go along with your contention,
I'd be happy to look at whatever evidence you have.

First we need a few clarifications. Is Ymir a superior being? Did he
create life? I don't consider sweating to be creation, but perhaps you
do. Is Coyote or Raven a superior being?

If you will look closely, you will see that "grammatical rules" is only
a metaphor as used here. They aren't really the rules you need to
construct DNA "sentences", whatever that would be.

Umm, instructions.

A sentence is instructions? What instructions, exactly? Are you talking
about the genetic code? If so, that's an extraordinarily simple language
with only 64 words, many of them synonymous, and almost no grammar.

OK, you've just described it in the terms of language - words, synonyms,
and at least *some* grammar. But my analogy is flawed?


Yes. You're using the analogy to claim that DNA is too complex to have
arisen naturally, because most languages are very complex. But if the
DNA language is very simple (as it is), your point disappears.

It's not the simplicity of the language characters or even the
grammatical rules - it's the *meaning* it can code for - that determines
it's specified complexity.

If these four characters, which can be arranged in only "64 words, many
of them synonymous, and almost no grammar", can code for all the
trillions of specialized functions that have existed since life began on
this planet, then I'd say that's a pretty powerful language!

But is the meaning in the DNA? I would argue that it isn't. The meaning
is in the function of the proteins and other structures that emerge in
development, and in the environment in which they are functional. That's
why this idea that DNA is a language is absurdly inappropriate.

How? Can natural selection *force* advantageous mutations to take place?
Sure, it can select from them *if* they take place, but it (NS) has no
creative power.


True. But in fact advantageous mutations do happen randomly. This has
been demonstrated many times in laboratory experiments. Natural
selection picks out the good ones and throws away the bad ones. Even if
the number of bad ones greatly outnumbers the good ones, this can
produce improvement.

But what is the price of these advantageous mutations? What function is
lost? Is the resultant sequence more or less specific than the
pre-mutation sequence?

Sometimes it's more specific, sometimes it's less specific. Depends on
what happens to be advantageous at the time. Your claim that mutations
never produce greater specificity is easily falsified. I've cited one
scientific paper that shows the evolution of greater specificity. There
are plenty of others.

Just because mutation can provide an advantage (rarely), doesn't mean it
is capable of adding specified, complex biological information to the
genome. And this *had to* happen countless times to get from the simple
lifeform that (allegedly) started it all to all the lifeforms that have
existed along the way - including us.

Maybe. But so far you have no means of identifying specified complexity
or telling me when it's increased or decreased.

If mutations don't add specificity *and* complexity to the genome, they
are most likely *not* the mechanism that produced all the specified
complexity of life.

Well, I think they do, to the extent that I have any idea what you mean
by specificity and complexity (and specified complexity, if that's
something different). If you can explain how to recognize these, I can
probably show a mutation or two that has increased each of them.

And random DNA sequences often have
functions; that is, they have measurable activity when tested against
some criterion.

And BTW, mutations and evolution is *your* mechanism. I don't need it
for my hypothesis. Why is it that you can propose a mechanism and not
have to show that it is capable of performing the task? Interesting.


At least my mechanism can be shown to exist. If you have a mechanism
(which you have not actually mentioned so far), I doubt you can do that
much for it.

Actually I did mention a mechanism in my original post. You should read
it sometime.
(I know I'm a smarta** - sorry!)

You mentioned what you may imagine is a mechanism, but I don't think so.
Care to repeat your claim in a stronger and more intelligible form? At
any rate, the main point is that this "mechanism" of yours can't be
shown to exist.

No?

I'm aware of it. I don't think you have any more idea what it means than
anyone else. The "sons of god" are not identified as creators. Only god
is so identified, and that only in the first 6 days of the universe.

Hmmm... "Let *us* make man in *our* image.". Who is "us"?

Now that's a theologically difficult problem. Some would say that it's a
remnant of polytheism in the bible. But you seem to think that "us" is
the sons of god. What evidence do you have for that?

None really. But if there was more than one designer (designated by the
"us" and "our"), it might be that they were these "sons of god" - that's
all.


That's nothing.

OK, so who are they?


No idea. It's a passing reference that could be all sorts of things. It
might even be what you think. But certainly it's not evidence.

[snip]

"Eyes" is just too vague to be a useful character. Homology has to be
better suggested than that in order to make anything work. You might as
well sort by size or color if you're going to to it in that half-assed way.

So sight systems which all generally work in the same fashion -
eyeballs, lenses, retinas, optic nerves, sight sensors in the brain,
etc. - are too vague to use as a classification?


In fact they don't all have any of those things. Insects have no
eyeballs or retinas.

"An insect retina without microvilli in the male scale insect,
Eriococcus sp. (eriococcidae, homoptera)."
http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=639083&dopt=Abstract

"What the Student will Learn: The student will gain an appreciation of
the similarities and differences in genome structures of different
insect species, and how these are manifested in differences in the
development and organization of the insect retina."
http://72.14.207.104/search?q=cache:HF_HK7CDKUUJ:www.nd.edu/~biology/reu/2004_Projects.htm+insect+retina&hl=en&gl=us&ct=clnk&cd=3

These are the *first two* results in a google search for "insect
retina". Apparently someone out there disagrees with you.

Perhaps. You understand that the retina, if you want to call it a
retina, has no resemblance to a human retina. Each ocellus has its own
single-celled retina. Nothing like ours.

Nautiluses have no lenses. Jellyfish have no
brains, much less sight sensors in them. Yet they all have eyes. "Eye"
is just a general term for something that senses light. Your ignorance
of biology is profound.

"Eight of the eyes on a box jellyfish have surprisingly good lenses, yet
the structure of the eyes keeps them from focusing sharply, according to
a new optics study."
And
"Box jellyfish may teach us something about how the first lenses in eyes
appeared,"
http://www.sciencenews.org/articles/20050514/fob2.asp

"And, no, jellyfish don't have brains -- because their bodies are
organized differently from ours. Most animals we encounter have what's
called bilateral -- or two-sided -- symmetry. They have a head end and a
tail end. In the head end, they have a concentration of nerve cells --
where these cells are complex, we call it a brain."
And
"Jellyfish have a loose network called a "nerve net" throughout their
bodies. When any part of the nerve net is stimulated, an impulse travels
across it in all directions."

So jellyfish don't have a "brain" as we call it, but their eyes are
connected to their central nervous system which is essentially a
decentralized brain.

They don't have a central nervous system. How can you say "central" and
"decentralized" at the same time? A nerve net is not a brain.

BTW, how are these jellyfish "eyes" going to help us understand the
evolution of the eye if they really aren't "eyes"?

In two ways. First, their homologous commonalities, or lack thereof, can
tell us about the phylogenetic history of eyes. Second, their
non-homologous similarities can tell us about the features of eyes that
are expected to evolve convergently.

Interesting.
But I guess most eyes have as much in common as chair legs with human
legs, and elephant trunks with car trunks, etc., oh yes, I forgot.


No, it's not that you forgot. It's just that you don't know much about
the diversity of life.



In the way organisms are classified? I don't think so.
What you have is a nested hierarchy which concentrates on certain traits
at the exclusion of others.

With good reason. Some traits are not useful in determining relationships.

Why not?
*ALL TRAITS* had to come from some common ancestor.


No they didn't. Not in the sense you are using "trait". Potatoes have
eyes; just because you use the same word in English doesn't mean that
anyone would postulate homology.

You *know* that I'm not just using similar terms. Eyes all perform
similar functions - namely Sight. Potato "eyes" have no function for
sight. Somehow, I don't think I should have to be explaining this to you.


It was an extreme example. There are no universal features of eyes
except that they are organs for sensing light. Just because we call them
by a single name is no reason to lump them all together. We could as
easily have given the eyes of different animals different names, and we
wouldn't be having this conversation. We could, for example, have given
all the various sorts of gills, lungs, tracheae, etc. the name
"breathers", and you would then be demanding that we call that one
characteristic. The vagaries of language are not a good guide to
character analysis.

Ah yes, but you guys point to these unrelated "sensors of light" as
evidence for eye evolution whenever it suits your purposes. So which is
it - are they related or no?

Some are, some aren't. Some features in those that are related are
themselves related, and some aren't. And "eye evolution" can refer to a
single process or to multiple convergent processes, each of which is
interesting in its own way.

What qualifies a trait as "useful" for classification?
What disqualifies a trait?
Who decides this?
I suggest to you that the reason they "are not useful" is that they
don't "fit".


You can suggest what you like, but you are not familiar with the facts.
There is a considerable literature on how to hypothesize homology of
traits, which you do before you put them all together in a phylogenetic
analysis. Homology is proposed based on detailed analysis of structure,
developmental origin, and topological relationships. Some characters are
too variable within species, which suggests they would be randomized
between species. And of course molecular homology is ridiculously easy
in most cases.

These characters which are "too variable" are the ones that don't work.

No, they're the ones that are demonstrably variable within species. It's
really a simple concept. If the number of hairs on a leg varies within
one species from 30 to 80, you can't use the fact that a given
individual of one species has 42 and one of another species has 42 also
as a guide to relationships.


For instance, lets take the trait "sight". Then lets classify all
organisms with this trait (insect, reptile, mammal, amphibian, fish...
etc.) - branching back to the first organism that "developed" this trait.

Like this one. Sight is not a useful trait for phylogenetic analysis.
It's too vague.

Wait a minute. All sighted animals have common traits in their eye
systems. Are you suggesting that they are not "related"?
Or does this just causes too many problems for the imaginary hierarchy.


No, they don't all have common traits.

Really? Name an eye system that does share *any* common traits with
other eye systems.

That's a different question. Every eye system shares some common traits
with some other eye systems. But there is no single trait shared among
all eyes. You can use the different shared traits to help in determining
phylogeny, though.

Sensing of light and stimulating nerve cells is not a common trait?

It's a trait that must be common by definition, because if it wasn't
there you wouldn't call it an eye. By the way, some eyes don't stimulate
nerve cells, at least not in the way you think. Consider the pineal eye.
It detects light, but its influence is by glandular secretions.

A lot of them do, and those may
be homologous.

May be? I guess that means all these "volumes of books" written on the
subject haven't really delved into that yet - huh?


You guess because you've never read anything about the subject except on
a creationist web site. I was talking about the interesting common
feature of bilaterian eyes that they are all (or at least those we've
examined closely) induced by a gene homologous to Pax-6. It's not quite
clear whether this is because there is a common ancestor with eyes, or
because Pax-6 was convenient to be recruited for the purpose when eyes
were developed separately.

Some features of some eyes are clearly homologous. Others are clearly not.

Yes, if your goal is to connect the dots between species, I'm sure some
times it works and sometimes it doesn't.

Again the claim, based on your personal ignorance, that there is no real
nested hierarchy of life. We'll discuss this further when and if you
have learned something.

OK, then lets consider the trait of "claws" and lets classify every
organism that has claws back to the original organism which "developed"
claws.

Same with claws. All manner of different structures with different
developmental origins are called "claws".

I see how it is. Certain structures (the ones that fit the ToE) are
permitted as "classifiable". The ones that don't fit the theory are not.


You see nothing. But if you think morphological characters are
subjective, what about molecular ones?

As usual, you ignore this argument.

Actually the molecular argument gives more credence to my point of view.
When you just look at things on the surface, you can assume evolution of
features as rather "easy". When you break it down to the molecular level
it gets far more difficult to explain.

So you claim. I doubt you can back that up. At any rate, I wasn't
talking about proteins (which is what you presumably mean, whether you
know it or not) but DNA sequences themselves. They show a nested
hierarchy, including those sequences that have no functions.

Then lets take the trait "tongues" and classify every animal which has a
tongue back to the first organism to "develop" a tongue.

That's a bit better. Tongues actually are homologous, unless you count
butterfly or bee "tongues".

If they have them, then yes, they must "count".


Add this to the list of things you don't understand: how human language
works. We assign the same words to all manner of quite different
objects. You can't just go by words when studying characters. You have
to look at what they actually are.

There you go again. I know the differences between inanimate legs, arms,
trunks, etc. and living ones. Don't play that game. It's getting old.


It's intended to illuminate the vagaries of common language and its
unsuitability as a guide to -- or as you seem to propose, substitute for
-- character analysis.

[snip]



There's your problems with language again. They don't have the same sort
of wings or legs as birds do. The brain may be homologous, though.

So their wings and legs mutated seperately from the original "worm"?
None of them followed the same path? But their eyes and brains did?


This is hard to interpret, because of the depth of your lack of
knowledge. Yes, wings and legs are separate developments, at different
times in different species. The common ancestor probably did have a
brain, i.e. an anterior thickening of the longitudinal nerve cord, and
may have had an eye spot.

Evidence for this creature?

If you mean fossil evidence, there is none. It's an inference from the
common characteristics of bilaterians.

But I wasn't talking mainly about these physical characters. I was
talking about DNA sequences. Take any random DNA sequence out of a
human, say, and then find the similar sequences in a bunch of other
primates. You get a nice, nested hierarchy. But here's the trick: take a
different random sequence, and you get the same hierarchy. No matter
what sequence you pick, same story. Now why should that be?

Because their designs are so similar. The same is true of pretty much
all designs everywhere. Take any car and you'll find similarities to any
other car. Take any computer, piece of furniture, etc.
Take any known design group and try it for yourself. It works! You'll see.


Afraid not. It doesn't work. Bet you haven't tried it. At any rate,
similar design doesn't explain the consistency of the nested hierarchy
you get from different genes. Remember, much of the variation is silent,
so design has nothing to do with it. You need to explain why, for
example, bat DNA is more like human DNA than bird DNA,

Because bats are more like humans than birds.

In what ways? And why do you think they are? Further, why should they be
more like humans and birds in all ways, even in those ways connected
directly to flight? I thought function was supposed to determine
similarity here.

You like to look at the surface and assume things - look at a bat and
tell me if it's features (sans the wing skin) more closely resemble a
human or a duck.

They more closely resemble a human. But why should they? They fly, don't
they? Shouldn't much of this functional similarity to a bird in
morphology be reflected in DNA too? But it isn't.

or why whale DNA
is more like cow DNA than whale shark DNA,

Whales are *mammals*!!! So are cows. Sharks are not.


What is a mammal? To me, that term makes sense as a set of species
descended from a common ancestor. But to you, what could it possibly
mean? Why should there be a correlation between feeding young on milk,
having hair, and having exactly 7 cervical vertebrae? And why should
this matter to DNA that isn't concerned with milk, hair, or vertebrae?
Why are even the useless parts of the whale DNA more similar to those of
cows than of sharks? And what about those parts directly concerned with
making fins and streamlined bodies? Shouldn't they, on your theory, be
more similar in whales and sharks, which share a body shape? Yet the
entire genomes tell the same story: whales are mammals, not fish. That
just makes no sense under your theory, but it makes perfect sense under
mine.

It actually makes perfect sense to me. Your mindset is so steeped in
evolution, you have no concept of "my" theory.

I notice you didn't explain why it makes sense. You just assert that it
does.

or why elephant shrews are

more like elephants than shrews.

No idea on this one.


Perhaps you should think about it. Look up "Afrotheria".

[snip]



Actually, many other mammals use echolocation, though not in as
sophisticated a form. And bat wings are just mammal forelimbs.

Like human forelimbs?


Exactly. Now you're getting it.

So their DNA should be similar? I think I already said that.

The little bit of their DNA that is responsible for making forelimbs
might be similar for this reason. But what about all the other DNA that
doesn't make forelimbs? Why should a bat and a human have exactly 7
cervical vertebrae, when no other flying animal does? Why hair? Why a
double occipital condyle instead of a single one? Etc.

What about the Platypus? It has traits that appear to be "borrowed" from
other lineages. Where does it fit?

It's a monotreme, related most closely to echidnas, and monotremes are
the sister group of all other mammals. Those traits you think are
borrowed are only superficially similar to, for example, a duck's bill.
Platypodes are in fact nicely and consistently placed within that nested
hierarchy.

So you say. I prefer to think of it as a unique design - only "related"
to the others you cite by the fact that it's design has similarities to
their designs and *that* requires similar coding.

As I have explained, it doesn't require similar coding, because most of
the "coding" has nothing to do with the design. You also have to explain
why all these similarities display a nested hierarchy.

I think you're ignoring the vast majority of coding and honing in on a
few examples myself - two of which I've already debunked.


Are you talking about the "eyes" and "legs" here? Because that was just
silly. I can't see that you have debunked anything. At any rate, you are
ignoring the DNA entirely. Why?

No, I was talking about the bats and whales.

You haven't debunked those. As I have explained, even the parts of the
genome that do nothing whatsoever match between mammals, and even
better, the parts that produce organs functionally similar to those of
birds and fish match between mammals. So your functional explanation is
refuted in two different ways.


There's no *real* evidence that it descended from them now is there?
It's just a guess.

It is to the same extent that anything else in science is just a guess.
Unfortunately, this bit of science isn't as easy to understand as some.
You will have to work at it just a little bit. But yes, the evidence is
clear and overwhelming. Would you like to see some of it?

Yes.


Here you are. This is a post I wrote some time ago. Read carefully. Let
me know if you have questions.

-----------------------------------------
[You need to view this in a font in which all the characters take up the
same amount of room. If you view it in a proportionally-spaced font,
both the tree and the DNA sequence will fail to line up properly.]

Evidence for human relationships to the other apes.

But first, a primer on DNA and how it can be used to understand
phylogenetic relationships. If you understand
this already, skip ahead to "Here is a set of DNA sequences" below the
dotted line.

DNA is double helix, each half being a twisted string of chemicals,
called bases or nucleotides, on a backbone. The bases come in four
flavors, each with a slightly different chemical formula, which can be
represented as single letters: A, C, G, or T, from the first letters of
each chemical's name. Because each of the two strings completely
determines the other one, we can ignore one of them, and because of
DNA's beads-on-a-string structure, we can completely describe a given
gene by a linear sequence of the four bases. So if I tell you that the
DNA sequence in some gene in some species is AAGAAGCTAGTGTAAGA, I have
completely described that particular part of the DNA molecule.

Different species have slightly different sequences, and when we line up
the corresponding sequences from different species, the patterns of
bases (letters) at each position (or site) in the sequence can tell us
about their relationships. Consider a set of 5 species. At any
particular position in the sequence each species has either A, C, G, or
T. For my purposes I don't care about the particular bases, only about
the patterns of similarity, so I'm going to use a different symbolism to
describe those patterns. I'll use lower case letters to represent
identical bases. So if I say a position has pattern xxxyy, I mean that
the first three species have one base and the last two have another. The
real bases could be TTTCC, GGGAA, or any other combination. There
are many possible patterns: xxxxx, xyzaz, xyxyy, etc. But only a few of
them can be used to determine relationships. It should be obvious that
xxxxx, all bases the same, tells us nothing. If only one base differs,
such as xyxxx, that also tells us nothing except that one species is
different from all the rest; but we already knew it was a separate
species. The only patterns that make a claim of relationships are those
in which two species have one base, and the other three have another:
xxyyy, xyxyx, xxyxy, and so on. (Actually, patterns like xxyzz tell us
something too, just not enough for my current purposes.) Why is this?
Because such patterns split the species into two groups, implying a tree
that looks something like this:

y x If all the species on the left have state y, and
\ / all the species on the right have state x, then
\ / somewhere in the middle (the branch marked *),
y__\_____/ there must have been a change in that site --
/ * \ a mutation -- either from y to x or x to y
/ \ (we can't tell which from this information).
/ \
y x

A little further note: the patterns that I represent in rows above
(xxyyy, etc.) are shown in columns in the DNA sequences below. That is,
in the sequences below, you read across to find the sequence in a single
species, but you read down to read the contents of a single site in five
species. So the first column of the sequence, reading down, would be
AAGAG, which is an xxyxy pattern.

-------------------------------------------------------

Here is a set of DNA sequences. They come from two genes named
ND4 and ND5. If you put them together, they total 694 nucleotides. But
most of those nucleotides either are identical among all the species
here, or they differ in only one species. Those are uninformative about
relationships, so I have removed them, leaving 76 nucleotides that make
some claim. I'll let you look at them for a while.

[ 10 20 30 40 50]
[ . . . . .]
+ 1 2++ 3 11 +4 3 ++ 52+1 2615+4 14+ 3 3+6+
gibbon ACCGCCCCCA TCCCCTCCCT CAAGTCCTAT CCAATCTACT GTACTTTGCC
orangutan ACCACTCCCA CCCTTCCTCC TAAGACTCAC ACAACTCGCC ACACCTCGTC
human GTCATCATCC TTCTTTTTTT AGGAATTTCC TCTCTCCGTC ACGCTCTACT
chimpanzee ATTACCATTC CTTTTTTCCC CGGATTCTCC CTTCTTCATT ATGTCTCATT
gorilla GTTGTTATTA CCTCCCTTTC AAGAACCCCT TTCACCTATC GCGTCCCACT

[ 60 70 ]
[ . . ]
+++ +++1 + + 2 + +++
gibbon CCTACAGCCC AGCCAAACGA CACTAA
orangutan CCTACCGCCT AGCCATTTCA CACTAA
human CCCCTTATTT TCTTGTCCGG TGACCG
chimpanzee TTCCTCATTT TCTTACTCAG TGACCG
gorilla TTCCTTATTC TTTCGCCTAG TGATTA

I've marked with a plus sign all those sites at which gibbon and
orangutan match each other, and the three African apes (including
humans) have a different base but match each other. (That's the xxyyy
pattern mentioned above) These sites all support a relationship among
the African apes, exclusive of gibbon and orangutan. You will note there
are quite a lot of them, 23 to be exact. The sites I have marked with
numbers from 1-6 contradict this relationship. (Sites without numbers
don't have anything to say about this particular question.) We expect a
certain amount of this because sometimes the same mutation will happen
twice in different lineages; we call that homoplasy. However you will
note that there are fewer of these sites, only 22 of them, and more
importantly they contradict each other. Each number stands for a
different hypothesis of relationships; for example, number one is for
sites that support a relationship between gibbons and gorillas, and
number two is for sites that support a relationship between orangutans
and gorillas (all exclusive of the rest). One and two can't be true at
the same time. So we have to consider each competing hypothesis
separately. If you do that it comes out this way:

hypothesis sites supporting pattern
African apes (+) 23 xxyyy
gibbon+gorilla (1) 6 xyyyx
orangutan+gorilla (2) 4 xyxxy
gibbon+human (3) 4 xyxyy
gibbon+chimp (4) 3 xyyxy
orangutan+human (5) 2 xyyxx
orangutan+chimp (6) 2 xyxyx

I think we can see that the African ape hypothesis is way out front, and
the others can be attributed to random homoplasy. This result would be
very difficult to explain by chance.

Let's try a statistical test just to be sure. Let's suppose, as our null
hypothesis, that the sequences are randomized with respect to phylogeny
(perhaps because there is no phylogeny) and that apparent support for
African apes is merely a chance fluctuation. And let's try a chi-square
test. (I'm not going to explain chi-square tests here; just understand
that it's a statistical test that tells us the probability that we would
see the patterns we see if sequence differences were random.) Here it is:

hypothesis obs. exp. (obs.-exp)^2/exp.
African apes (+) 23 6.29 44.4
gibbon+gorilla (1) 6 6.29 0.0
orangutan+gorilla (2) 4 6.29 0.8
gibbon+human (3) 4 6.29 0.8
gibbon+chimp (4) 3 6.29 1.7
orangutan+human (5) 2 6.29 2.9
orangutan+chimp (6) 2 6.29 2.9
sum 44 44 53.7*

(*This column is rounded, so it doesn't quite add up here.)

These are all the possible hypotheses of relationship, and the observed
number of sites supporting them. Expected values would be equal, or the
sum/7. The important column is the third one, which is a measure of the
"strain" between the observed and expected values. The larger the sum of
this column ("the sum of squares"), the greater the strain. There are 6
degrees of freedom (meaning that if we know 6 of the observations, we
automatically know the 7th), and the sum of squares is 53.7. That last
number gets compared to a chi-square distribution to come up with a P value.

It happens that P, or the probability of this amount of asymmetry in the
distribution arising by chance, is very low. When I tried it in Excel, I
got P=8.55*10^-10, or 0.000000000855. That's pretty close to zero, and
chance can be ruled out with great confidence.

Having ruled out chance, now the question is how you account for the
pattern we see. I account for it by supposing that the null hypothesis
is just plain wrong, and that there is a phylogeny, and that the
phylogeny involves the African apes, including humans, being related by
a common ancestor more recent than their common ancestor with orangutans
or gibbons. How about you?

By itself, this is pretty good evidence for the African ape connection.
But if I did this little exercise with any other gene I would get the
same result too. (If you don't believe me I would be glad to do that.)
Why? I say it's because all the genes evolved on the same tree, the true
tree of evolutionary relationships. That's the multiple nested hierarchy
for you.

So what's your alternative explanation for all this?

My explanation is that you are *looking* for a relationship. The fact
that the "African apes" as you call them (and us) agree at only 23 out
of 76 places, but agree less with gibbons and orangutans doesn't show
any relationship between apes and man. It just shows that this sequence
is more similar amongst the African apes and man (I'll separate us out
for you).
You could substitute crabs and lobsters for the orangutans and gibbons
and get similar results. All you've shown is that gorillas, chimps and
humans are more similar than gorillas and orangutans, chimps and
gibbons, and any other of those combinations you mentioned.
Let me ask you this: Why did you concentrate on these species? Have you
looked at any other non-primate species' sequences for similar genes?
Are there any?

Yes, there are thousands of sequences for these genes from all manner of
organisms; animals, plants, protists, bacteria. Only primates are close
to humans, and chimp and gorilla are the closest. By the way, they don't
agree at only 23 of 76 places. You are misreading. They agree at 23 of
the 44 places that make some statement on that particular question. They
agree at hundreds of places, but most of those are not relevant because
all the apes are the same at those places.

This is not mere similarity, either. It's nested hierarchy. I could make
that more explicit by including more nested groups. We would find that
African apes and orangutans form a group exclusive of gibbons and
monkeys, and that all the apes form a group exclusive of New World and
Old World monkeys, and that apes and Old World Monkeys form a group
exclusive of New World monkeys and lemures. And so on. And every gene we
happened to look at would agree on all these points. No why would that be?

You say...what?
It's because of a necessary similarity between similar organisms? But
out of these 76 sites with informative differences, only 18 involve
differences that change the amino acid composition of the protein; the
rest can have no effect on phenotype. Further, many of those amino acid
changes are to similar amino acids that have no real effect on protein
function. In fact, ND4 and ND5 do exactly the same thing in all
organisms. These nested similarities have nothing to do with function,
so similar design is not a credible explanation.

Credible explanation for what?
The fact that similar information produces similar function? Or the fact
that different information produces similar function?
I'm not sure what you're getting at here.

Obviously not. You have missed the fact that most of these similarities
and differences are silent. That is, they do not produce a difference in
the protein they code for. Thus they have no function. You can't explain
it that way.

God did it that way because he felt like it? Fine, but this explains any
possible result. It's not science. We have to ask why god just happened
to feel like doing it in a way that matches the unique expectations of
common descent.

What "unique expectations"? What does common descent "expect"?

It expects a consistent, nested hierarchy, which is what these data
show. So would any other DNA you happened to pick out of the genome.
Same hierarchy. Why?

By the way, if you want to see the full data set I pulled this from, go
here:

http://www.treebase.org/treebase/console.html

Then search on Author, keyword Hayasaka. Click Submit. You will find
Hayasaka, Kenji. Then click on Search. This brings up one study, in the
frame at middle left. Click on Matrix Fig. 1 to download the sequences.
You can also use this site to view their tree. The publication from
which all this was drawn is Hayasaka, K., T. Gojobori, and S. Horai.
1988. Molecular phylogeny and evolution of primate mitochondrial DNA.
Mol. Biol. Evol., 5:626-644.
-------------------------------------------

[snip]


I'm saying something about complexity. But more specifically - specified
complexity. There's no denying that the functions that exist within the
human body require a much broader range of specified, complex coding
than those of any unicellular organism. The fossil record supports a
gradual introduction of more and more specific complexity into the
environment.

In fact, it doesn't. There are a few places where the maximum complexity
found in the biota seems to have a big increase, like around the
Cambrian explosion. But most of the time nothing special seems to be
happening. Nothing big has happened since the Cambrian, in fact.

"Specified complexity" and "complexity" are two different things.
In language, specified complexity is related in "meaning". Complexity
requires no meaning. A random string of letters increases in complexity
as it gets longer.
It's the same in genetics; You could have a long string of DNA which
codes for nothing and a short one that codes for several complex,
specific functions. The former is complex, but not specific. The latter
is specified *and* complex. The latter is what had to increase as life
evolved.
Human functions require much more specific, complex coding that the
functions of unicellular organisms - just like "War and Peace" requires
many more specified, complex sentences, paragraphs and chapters than
"Geen Eggs and Ham".


Until you can define this and give me a means of quantifying it, you
have nothing. As far as I can tell, specified complexity increases
whenever and wherever you want to say it does. There are no criteria by
which I can judge whether you are right or wrong.

Now, I'm no geneticist, so my terminology might not be 100% correct, but
hopefully you get what I'm trying to say here:
The criteria has to do with conditions and functional results. More
conditions producing fewer functional results means more specificity,
less conditions producing more (in quantity) functional results means
less specificity. It's simple logic.
Any DNA sequence codes for a set of amino acids, but do these amino
acids produce a function?
If a function requires a specific chain of amino acids it is more
specific than if a couple amino acids produce several functions.

This is clear as mud. No function that I know of requires a specific
chain of amino acids. They all can be produced by many different chains.
Most proteins can perform many different functions in different
circumstances, though there is most often one function that they do much
better than any others. This of course is subject to change through
mutation and selection. I'm afraid you have still not explained any way
to recognize specified complexity.

Mutation, on the other hand - destroys specified complexity.

That's an assertion. If you had a way to measure specified complexity we
could examine that. But you don't.

It is measured in it's exclusiveness. If a sequence only codes for one
thing, it's more specified than one that codes for two.

It's really not that hard.

I'm not sure what you mean by "codes for one thing" and "codes for two".
Any given sequence can only code for one thing, if you start at the same
point and end at the same point each time. So that made no sense at all.

I'm talking comparatively - as in before and after mutation. If the
sequence, before mutation, coded for one function and after mutation,
codes for two - (if that's possible) it has become less specific.

Ah, the term "thing" was ambiguous. So you're talking about functions,
not proteins. Yes, a protein can gain functions as well as lose them.
But it's odd; sometimes creationists call gains of function increases in
complexity, and sometimes they call losses increases in complexity. This
would be simpler if you would yourself be specific. How about talking
about a real case?

This is a good place to note again that you have confused two separate
issues: one, common descent; two, the mechanism responsible for
introducing innovation and causing adaptation. Please don't.

One requires the other.

Not true at all. Are you acquainted with theistic evolution, for
example? Or consider Michael Behe. He agrees with me entirely on common
descent, but disagrees on the mechanism responsible for introducing at
least some innovations. Is he being inconsistent?

If his mechanism is Intelligent Design, then it would sound like he
agrees with me as well.

He agrees with you on some things and with me on others. Which shows
that those things are separable, and that "one requires the other" is
false. Are you paying attention here?

[snip]



I *never* said evolution was impossible. I said it exists in two forms.

But it doesn't. There is only one form.

So you believe that the evolution of different bill shapes amongst the
Southeast and Laysan finches - which differentiated in a period of *only
twenty years* - was the product of random mutations?


Random mutation and natural selection, yes. Most of the genetic
variation was probably already in the population, but its ultimate
source was random mutation. There's probably no way to show that now (in
fact how could you show that a single mutation is random?), but it's
certainly possible. And there's no evidence to suggest otherwise that I
know of.

I think you just contradicted yourself.

Explain.

Until you have a way to measure
the specified complexity of two DNA sequences, and can show that
mutations never increase it, you have nothing.

Read Dr. Lee Spetner's "Not By Chance". It's been done.


If so, you will be able to present that method here. I have little
interest in reading Spetner's big book just to find that one little
point. How do you measure the specified complexity of two DNA sequences?

Which of these sequences has more specified complexity?:

TATCCTAAAGGACCCTTCCTGTCCAATACCCTCCGGAC
TATCCTGCAGAACACTCCTTACCCAGTACACAACAGAG

[snip]

I don't know. What are the resultant functions?

The functions are identical in this particular case. So we can't tell
from the DNA, then. We have to look at the functions of the proteins
that are produced. Right?

Yes, but they are selected in the environment that needs them. The
mutations - if they consistently happen - could be called "built in".

These types of mutations occur for the adaptation of the genome to it's
environment. It's like a built in spare tire.

These are well documented as happening *too fast* and *too frequently*
to be random.

If they are well documented, please cite something that documents this.

The previously mentioned finches (Conant 1988, Pimm 1988).
An entire population of guppies that changed in *two years* (Reznick 1997).


Those are fast. But why are they too fast for random mutation and
natural selection? How did you compute that?



Animals in colder climates have shorter protruding limps than the same
animal in warmer climates (Collier 1973)
How about Gloger's Rule?
Jordan's Rule?


Nothing here about how fast this happened, so irrelevant to your claim.



There are other studies involving rat jaws, high flying geese, etc.
These all show a "built in" evolution triggered by (or at least selected
by) the environment.


Precisely. Selected by the environment. Natural selection working with
random mutations is perfectly capable of producing all these phenomena.

No, I'm sorry, truly "random" mutations are not this precise. I predict
that any of these "random" mutations will be reproduced any time these
same animals are put in similar environments.
These "random" mutations are not "random" at all.

You misunderstand. These are not random mutations. They are the result
of selected mutations, and those particular mutations were selected from
a random set. Further, they are neither single mutations or,
genetically, the same mutations each time. You have confused selection
with mutation. No wonder you have problems.

There are in fact laboratory experiments, beginning with Luria and
Delbruck, showing that this is not the case. Particular mutations happen
at the same frequency regardless of need. What we do have is evidence
that, in some bacteria, stress can increase the frequency of random
mutations. But it doesn't produce just the right mutations, only more of
them.

These are what I'd call "built in". They are reproducable mutations that
the environment selects. It's the "spare tire" I mentioned.


Why do you call them "built in"? What evidence do you have that they are
more reproducible than random mutations? All the evidence I know of says
the opposite: nothing but random mutation with no special mechanism,
happening regardless of need.

So reproducible mutations which take over a population every time it's
put in a different environment are "random"?
OK...

You have shown no evidence of reproducible mutations, only of common
response to similar selective regimes. And the common response on an
anatomical level is hardly ever the same mutation or set of mutations on
a genetic level. There being so many different ways to accomplish the
same effect, that's quite unlikely, and experiments show this.
Identical-looking responses to selection in different species seldom
have the same genetic basis.

So, to sum up. You have attacked both common descent and the sufficiency
of random mutation and natural selection to account for adaptation. You
don't seem to realize that they are two entirely separate questions.

The evidence for common descent is overwhelming. The most telling
evidence is the nested hierarchy of life. You have attempted to attack
this in two contradictory ways. First, you claim that it doesn't exist,
and that scientists choose characters so as to force a hierarchy that
isn't there. Second, you claim that it does exist but is due to similar
design. The first is easily shown to be untenable by looking at
objectively scored but randomly chosen DNA sequences. The second is
untenable for two obvious reasons: 1) similar design doesn't explain
nested hierarchy unless there is some reason why designs should be
organized hierarchically, and there has been none advanced; 2) the
hierarchy occurs in sequences and sites in which differences have no
effect on phenotype, and for which there is therefore no functional
reason for similarity.

The evidence for the sufficiency of natural selection and random
mutation is less clear. We can't actually test whether a long-past
evolutionary change was caused by natural selection or some other
mechanism. But natural selection is a plausible cause consistent with
the evidence, and we know of no other mechanism that is in principle
capable of causing such adaptations. There is experimental evidence that
natural selection exists and can produce adaptive changes, even starting

from random DNA sequences. The sorts of mutations required to explain


observed differences among species happen naturally and randomly. And
again, there is no experimental evidence for the existence of any other
mechanism.

Natural selection is not a mechanism - it's a filter.

Semantic quibbling. Who says a filter isn't a sort of mechanism?

I do. It *produces* nothing - it has no *creative* power. It actually
*lessens* the chance that a mutation "makes it through". So you're
starting with a weak mechanism and making it weaker by producing a
filter that weeds out most of the results.

A common misunderstanding. You might have a point if most features arose
through single large mutations. Then, natural selection would have a
weak and non-creative role. But instead, we get small mutations that
move the phenotype a little distance along some path. And natural
selection has a creative role in keeping the phenotype moving along this
path, where random mutation would by itself produce a random walk.

> And I

noticed you ignored almost everything I said here.>

You mean the whole "the ToE predicts a nested hierarchy" argument?

Well, since the mechanism of evolution is unguided random mutations
"with no goal in mind", and since mutation more often than not causes a
*loss* of function, theoretically evolution can occur in any
"direction", but will most likely tend toward the "downward" as
functions are much more easily lost than gained.

Again, you ignore the role of natural selection. Think of it as a
ratchet. If you bump a ratchet randomly, even if most of the bumps are
in the wrong direction, the ratchet will move in the right direction.

Why then would the ToE "predict" a nested hierarchy that relies on the
*buildup* of specified complexity and functions?

In point of fact, it doesn't. It relies merely on there being changes of
some kind during a history of descent and branching.

It could just as easily predict the opposite outcome. In fact, given the
observed result of known mutations, the evolution of jellyfish from man
is much more likely than the reverse. There doesn't necessarily have to
be an "advantage" for natural selection to work it's magic. Functions
can be lost and selected - so long as the organism is able to survive
and breed - correct?

Correct. There are many cases of simplification during evolution,
especially in parasites. But that's not what the nested hierarchy is.
There is no implication of continually increasing complexity, and in
fact we don't see any such thing. The nested hierarchy is just a pattern
of groups within groups.

So, any "hierarchy" is possible with the ToE and therefore it is not a
falsifiable "theory". It predicts nothing in regard to the buildup of
functions over time.

Indeed it doesn't, but that's irrelevant to the point. The point is that
we see a particular nested hierarchy, and we see the same one no matter
which features of the organisms we look at. Nothing to do with
complexity at all.

Mutations -
specifically *random* mutations are the mechanism I'm proposing as not
up to the task of producing the *increase* in specified complexity that
*must have* been produced by "something" to get from soup to man (if
life evolved).
You've danced around the issue, but never really tackled it head on.


What's to tackle? You have presented no evidence that natural selection
and random mutation are incapable of doing anything. We have plenty of
evidence that they can increase the amount of information in a sequence
and that they can produce a variety of adaptations. And the genetic
differences between species are exactly the sort that can be produced by
a series of random mutations, with natural selection operating on a very
few of the bits.

Until you can define specified complexity to the point that I can look
at a DNA sequence and tell if it's increased or not, there is nothing
for me to work with.

Well, you are describing DNA sequences as "information", but I don't
know what type of information you are referring to.

Shannon information will do.

If you're using the
classic definition, then the functional outcome of the sequence is not
considered, only the total number of "bits" in the sequence - useful or not.
Measuring specified complexity with your method would then require a
method of measuring the number of specific "bits" required for
functions. The more bits *required* - the more specific the sequence
must be.
Requirements and outcomes must be considered in measuring specified
complexity.

You still don't present any method for determining specified complexity.
All you can do is wave your hands in the air. You are getting close here
to Kolmogorov complexity, but I don't think that's what you mean. At any
rate, the Kolmogorov complexity of a *function* in terms of DNA is
impossible to measure unless we test every possible DNA sequence to see
if it performs that function. And we would have to introduce some
quantitative test too, because there would be no sharp line between
"performs the function" and "doesn't perform the function". A given
protein would have greater or lesser activity in whatever function you like.

.