Re: Part 1 (of 3): What are major aspects of evolutionary theory?



>"Mochikomi" is not a term I know.

That was a joke. It means a loss without compensation.
(As opposed to a relocation, which is a loss one place and gain elsewhere.)
If you search Google you'll find definitions, mostly in terms of
invading where you lose all your troops and get nothing in
compensation, which is why it's a joke, because here nothing of value
is lost, just some junk DNA, like the TV commercial where the couple
are remarking about their old refrigerator which is junk and they wish
it'd just go away and indeed it breaks loose and drives away.

(Regarding a case where we're obviously looking at a chain of evolution
in reverse chronological order by mistake:)
> > Like I said, if we see a pattern of two different sequences gradually
> > evolving to become identical, and then suddenly at the point where they
> > are exactly identical one of the two copies exactly disappears:
> But we don't see this. We see various sequences with various differences
> and similarities. You aren't thinking very hard about what you
> hypothesize here, or about what sort of data you could observe.

But when we reconstruct the states of the internal nodes of our
unrooted DNA-sequence tree by use of majority rule, we might indeed see
such a pattern. For example, if the true evolution went like this:
a b
TGGACCTGTGGATAGCAACACGACCTT...TGGACCAGTGGATAGCACCACGAGCTT
|--TGGACaTGTGGATAGCAACACGAaCTT...TGGACCAGTGGATAGCACCACGAGCgT
| |--TtGACaTGTGGATAGCAACACGAaCTT...TGGACCAGTGGATAGCACaACGAGCgT (observed#1)
| `--TGGACaTGTGGATAGCAACACGcaCTT...TGGACCAGTGGAaAGCACCACGAGCGT (observed#2)
`--aGGACCTGTGGATAGCAACACGACCTT...TGGACCAGTGGATAGCAtCACGAGCTg
|--aGGACCTGTGGATgGCAACACGACCTT...TGGACCcGTGGATAGCAtCACGAGCTg
| |--aGGACCTGTGGATgGCAAtACGACCTT...TGGACCcGTGcATAGCAtCACGAGCTg (obs#3)
| `--aGcACCTGTGGATgGCAACACGACCTT...TGGACCcGTGGATAGCAtCACGAGaTg (obs#4)
`--aGGACCTGTaGATAGCAACACGACCTT...TGGACCAGTGGcTAtCAtCACGAGCTg (observed#5)
(Lower case shows any mutations from original sequence.)
First we align all the observable data (2 aligned segments each from 5
taxa, 10 sequences total) (note the capitalization is not visible):
1 2
123456789012345678901234567
1a = TTGACATGTGGATAGCAACACGAACTT
1b = TGGACCAGTGGATAGCACAACGAGCGT
2a = TGGACATGTGGATAGCAACACGCACTT
2b = TGGACCAGTGGAAAGCACCACGAGCGT
3a = AGGACCTGTGGATGGCAATACGACCTT
3b = TGGACCCGTGCATAGCATCACGAGCTG
4a = AGCACCTGTGGATGGCAACACGACCTT
4b = TGGACCCGTGGATAGCATCACGAGATG
5a = AGGACCTGTAGATAGCAACACGACCTT
5b = TGGACCAGTGGCTATCATCACGAGCTG
Now if we construct an unrooted parsimony tree for those sequences, we
should get:
1a--x--y-----------l--k--1b
| | | |
2a z--5a 5b--m 2b
| |
3a--w--4a 4b--n--3b
Now let's reconstruct the internal nodes by majority rule:
For example, at site 1, we have:
T--x--y-----------l--k--T
| | | |
T z--A T--m T
| |
A--w--A T--n--T
Majority rule gives us:
T--T--T-----------T--T--T
| | | |
T A--A T--T T
| |
A--A--A T--T--T
We got that one right! (It matches the actual original genome.)
That happened to identify a mutation that occurred right after the
original genome.
Let's try another example, site#3 which got a very late mutation:
G--x--y-----------l--k--G
| | | |
G z--G G--m G
| |
G--w--C G--n--G
Majority rule gives us:
G--G--G-----------G--G--G
| | | |
G G--G G--G G
| |
G--G--C G--G--G
Again that matches what actually happened.
One last example, site #24, where the original genome already had a
difference, but where a new mutation occurred within one copy:
A--x--y-----------l--k--G
| | | |
A z--C G--m G
| |
C--w--C G--n--G
Applying majority rule:
A--A--y-----------G--G--G
| | | |
A C--C G--G G
| |
C--C--C G--G--G
At internal node y we can't choose among three different votes, so we
leave that undecided. This kind of ambiguity happens only when a single
internal node is the meeting poing of three solid block-votes. If the
second mutation at the same site had happened later, for example:
A--x--y-----------l--k--G
| | | |
A z--A G--m G
| |
A--w--C G--n--G
Then majority rule would have revealed the internal states without ambiguity:
A--A--A-----------G--G--G
| | | |
A A--A G--G G
| |
A--A--C G--G--G

So I claim that by such majority-rule reconstruction of state of
internal nodes, we have trouble only when more than one mutation occur
close together, in which case those rare sites at those rare internal
nodes have to be left undecided, but the states of the vast majority of
sites in internal nodes can be resolved, and thereby we now have actual
chains of known genome through the tree and can observe divergence.

By the way, we didn't even have to reconstruct the states of the
internal nodes to deduce that the whole-genome node containing
sequences y+l is the root of the tree. All we had to notice is that the
tree followed a mirror-image pattern, with corresponding pairs of
terminal nodes exactly matching the five whole-genomes. This shows that
the two copies co-evolved within a single clade, whose rooted tree is:
--(original)
|--(LCA of 1+2)
| |--(observed#1)
| `--(observed#2)
`--(LCA of 3+4+5)
|--(LCA of 3+4)
| |--(obs#3)
| `--(obs#4)
`-(observed#5)

Now what if some of the sequences in some of the observed genomes
weren't observed, i.e. we missed one of the two copies in some genomes?
So when we construct the unrooted parsimony tree we get:
1a--x--y-----------l--1b
| | |
2a z--5a 5b--m
| |
3a 4b--n--3b
I think it's clear that the tree shows two copies co-evolving in a
single evolutionary tree, with root at y+l, but with it unknown why
sequences 2b and 4a are missing, because they actually suffered DEL
events, or because we simply failed to sequence them yet. We might now
try DNA hybridization to look for them, using their nearest relatives
1b and 3a as probes.

If we get a tree like this:
1a--x--y--------------k--1b
| | |
2a z--5a 2b
|
3a--w--4a
we can be pretty sure a true deletion occurred along the mirror image
of the y-z branch.
..

.



Relevant Pages

  • Re: A few bonobo & chimp genes more related to our own
    ... In 453 of their sequences, ... What you get from homologous stretches of DNA from different species is a gene tree. ... This is usually pretty similar to the underlying species tree, but there are a variety of processes which can cause them to diverge. ... The gene tree has been incorrectly determined: that is, phylogenetic analysis has produced an estimated tree that doesn't match the true gene tree. ...
    (talk.origins)
  • Re: Part 1 (of 3): What are major aspects of evolutionary theory?
    ... We see various sequences with various differences ... By rooting the tree, or by assuming a molecular clock that roots the ... >>>What about duplications followed by later divergence of the copies? ... > clade of sponges becomes eumetazoans, the unrooted tree should look ...
    (talk.origins)
  • Re: Weirdos Irony Meter Just had a Blowout.
    ... organisms - which is what a phylogeny is SUPPOSED TO DO. ... trees are generated from sequences that ... I never said it was a phylogenetic tree'. ... above infinite tree of. ...
    (talk.origins)
  • Re: An uncountable countable set
    ... binary sequences, i.e ., infinite sequences whose terms were from a set ... And my tree shows that the complete set can be listed in form of a ... It is only the set of individualy infinite paths in that tree that are ...
    (sci.math)
  • Re: tricky tree-structure question
    ... leaves are kept in one table, and internal nodes in another. ... the third table might contain grades, which teachers give students / ... grades are only given down the tree (meaning- a principal may grade a ... one node cannot grade a node in a different tree. ...
    (comp.databases)

Loading